GATE 2006 PAPER

BIOCHEMISTRY

Q.1 – Q.6 carry one mark each

1. Which of the following amino acids does NOT contribute to fluorescence of a protein?

(A) Tyrosine (B) Phenylalanine
(C) Cysteine (D) tryptophan


2. Immunological memory is manifested during

(A) primary immune responses
(B) non – specific immune responses
(C) innate immune responses
(D) secondary immune responses


3. The main function of the pentose phosphate pathway is to

(A) supply ribose 5 – phosphate and NADPH
(B) supply NADH and ATP
(C) provide a mechanism to use the carbon skeletons of excess amino acids
(D) provide carbon skeletons for oxidation of fatty acids


4. Which on the following CANNOT BE considered as a weak interaction?

(A) Van der Waals forces (B) Peptide bonds
(C) Hydrogen bonds (D) Ionic interaction


5. Polynucleotide kinase is used

(A) to add a nitrogenous base at the 5`end of DNA
(B) to add a nitrogenous base at the 3` end of DNA
(C) to add a phosphate at the 5`end of DNA
(D) to add a phosphate at the 3`end of DNA


6.

Q.7 – Q.24 carry two marks each


7. FOS, JUN, and MYC are

(A) proteins expressed on the surface of cancerous cell
(B) protein kinase that phoporylate transcription factors in cancerous cell
(C) proteins involved in regulation of expression of genes involved in growth promotion
(D) proteins involved in ion transport in cancerous cells


8. using micro array technique it was demonstrated that when a mammalian cell line was exposed to a drug, the expression of 10 genes is increased. Which of the following pairs of techniques could be used to validate micro array data?

(A) southern blotting and polymerase chain reaction
(B) northern blotting and fluorescence insitu hybridization
(C) southern blotting and reverse transcriptase- PCR
(D) northern blotting and RT-PCR.


9. Pepsin hydrolysis of IgG molecule will result in the production of

(A) one Fc fragment and one F (ab`)2 fragment
(B) one Fc fragment and two Fab fragment
(C) one Fc fragment and one Fab fragment
(D) one F (ab`)2 fragment and one Fab fragment


10. select the correct combination to fill in the blanks
----------- are responsible for the production of antibody against free pathogens and soluble products from pathogens while --------- destroy pathogen and virally infected cells and abnormal cell.

(A) Cytotoxic T cells and B cells
(B) Macrophages and T cells
(C) B cells and Helper T cells
(D) B cells and Cytotoxic T cells


11. Select the correct primar pair for the PCR amplifiation of the following DNA fragment:
5`- TTTTTTTTTTGTAACTCGGTCGTAGGCATTGAACTATGCGGGGGGGGGG-3`

3`- AAAAAAAAAACATTGAGCCAGCATCCGTAACTTGATACGCCCCCCCCCC- 5`


(A) 5` TTTTTTTTTT 3` and 5` GGGGGGGGGG 3`
(B) 5` AAAAAAAAAA 3` and 5` CCCCCCCCCC 3`
(C) 5` TTTTTTTTTT 3` and 5` CCCCCCCCCC 3`

(D) 5` AAAAAAAAAA 3` and 5` GGGGGGGGGG 3`


12. THE DOUBLE – RECIPROCAL TRANSFORMATION OF THE Mihaelis – menten equation, also called the Lineweaver – Burk plot, is given by
1/V0= Km/(Vmax[S])+1/Vmax to determine Km from a double – reciprocal plot, you would

(A) take the reciprocal of the y – axis intercept
(B) take the reciprocal of the x – axis intercept
(C) multiply the reciprocal of the x – axis intercept by – 1
(D) multiply the reciprocal of the y – axis intercept by – 1


13. Which of the following statements is INCORRECT?

(A) Most of the eukaryotic mRNA’s have a 7-methylguanosine cap at their 5` end
(B) TATA binding protein is involved in the synthesis of mRNA, tRNA and rRNA
(C) Histones have no other function except in chromatic organization
(D) Eukaryotic RNA polymerase II consists of more than 4 subunits


14. The organization of an eukaryotic gene expressed at high levels in liver s diagrammatically represented below:





5`UTR Intron 1 Intron 2 3` UTR
0.4 kb 1.0 kb 3.0 kb 0.6 kb

The size of the mature mRNA generated by the transcription followed by normal splicing of this gene will be (assume that this mRna is not polyadenylated; 5` UTR and 3` UTR refer to 5` and 3` untranslated regions respectively)

(A) 12.4 kb (B) 13.0 kb (C) 12.0 kb (D) 12.6 kb


15. Incubation of a cell extract containing all enzymes of glycolysis with [-32P] ATP and unlabeled inorganic phosphate results in the formation of which of the following labeled compounds ( assume that pyruvate kinase is inactivated)?
1. Glucose – 6 – 32 Phosphate
2. (3 – 32P) – Phosphoglycerate
3. (1 – Phospho – 3 – 32Phospho) - Bisphosphoglycerate
4. (1 – Phospho – 3 – 32Phospho) – Fructose bisphosphate

(A) 1 and 3 (B) 1, 2 and 3 (C) 2 and4 (D) only 4


16. Electrophoresis of a purified protein named X in the presence of sodium dodecyl sulfate and 2 – mercaptoethanol, shows a single band of 45kDa. In gel filtration column chromatography, protein x elutes between alcohol dehydrogenase (160kDa) and beta – amylase (190kDa). How many identical subunits is protein X composed of?

(A) One (B) Two (C) Three (D) Four


17. Identify the correct pairs for the primary functions of the different enzyme classes
P. Kinases 1. cleave bonds by elimination
Q. Lyases 2. make large molecules from small molecules
R. Synthases 3. transfer phosphate group to biomolecules
S. Phosphates 4. remove phosphate group from biomolecules


18. Which of the following statements about the mitochondrial proton gradient and membrane potential is correct?

(A) Either of them is sufficient to make ATP from ADP + Pi
(B) Both are required to make ATP
(C) Usually cancel one another since the system is at equilibrium
(D) Neither of them is required for ATP synthesis




19. The molecule shown is:

-OOC NH3+

H2C

O

OP---O

O

O O

O O

R R



(A) phosphatidylserine
(B) phospophatidylcholine
(C) phosphophatidylethanolamine
(D) phosphotidylinositol


20. Melting curve of two DNA specimens X and Y at the same pH and ionic strength have Tm values of 85C and 80 C, respectively. This means that

(A) the AT content of Y is higher than X
(B) the GC content of Y is higher than X
(C) the AT content is same in X and Y
(D) the GC content X of is higher than Y


21. Part of the overall flow in amino acid catabolism is shown in the figure. Identify X and Y


22. Which one of the following statements refers to glycogen, and which one refers to cellulose?

I. Branched molecule containing -1,4-glycosidic bond
II. Straight chain molecule containing -1,4-glycosidic bond
III. Branched molecule containing α-1,6- glycosidic bond
IV. straight chain molecule containing α-1,6- glycosidic bond

(A) I = Glycogen; IV = Cellulose
(B) II = Glycogen; III = Cellulose
(C) III = Glycogen; II = glycogen
(D) IV = Glycogen; I = Cellulose


Common Data Questions


Common Data for questions 23,24:


23. The dihedral angle indicated by an arrow in the tripeptide structure corresponds to the
(A) psi angle (B) phi angle (C) chi angle (D) omega angle


24. The amino acid sequence of the above tripeptide is
(A) Glutamine – valine - threonine
(B) Asparagine – valine – serine
(C) Glutamine – leucine – threonine
(D) Asparagine – valine – threonine


Linked Answer Questions: Q.25 to Q.28 carry two marks each


Statement for Linked Answer Questions 25 & 26:

Binding of glucagons to its receptor results in the generation of a specific second messenger.


25. Which of the following second messengers is generated in this case?
(A) Calcium (B) cGMP
(C) Phosphatidylinositol (D) cAMP


26. Which of the following enzymes is activated by this second messenger?
(A) Protein kinase A (B) Protein kinase C
(C) Phopholipase C (D) Protein phosphatase 2A


Statement for Linked Answer Questions 27&28:

The figure shows the oxygen binding curves for the hemoglobin (Hb) and Myoglobin (Mb).





27. Identify the correct curves for Hb and Mb
(A) P:Mb; Q:Hb (B) Q:Mb; P:Hb
(C) R:Mb; Q:Hb (D) S:Mb; R:Hb


28. Sickle cell anemia due to the formation of a hydrophobic patch in one of the proteins shown in the above curves. Thisis due to the replacement of
(A) Glu 6 by Val 6 in the  subunit of P
(B) Glu 6 by Val 6 in the  subunit of Q
(C) Glu 6 by Val 6 in the  subunit of R
(D) Glu 6 by Val 6 in the  subunit of S



Solutions


1. (C) Since, rest are aromatic compounds


2. (A)


3. (A)


4. (B) Since, it is a covalent bond


5. (C) It can add a phosphate to 5` end only after the replacement of initial phosphate by CIP


6. (D) Since, there is deoxyribose sugar, phosphate and a N2 base. This makes DNA.


7. (C)


8. (D)


9. (A)


10. (D)


11. (C) Plymerisation always proceeds from 5` to 3`.


12. (B)


13. (C)


14. (B)


15. (B)


16. (D)


17. (B)


18. (B)


19. (A)
Phosphatidylserine – CH2CH(NH3+)COO+
Phsophatidylcholine – CH2CH2N(CH3)3+
Phosphatidylethanolamine – CH2CH2NH3+


20. (D)
G  C has 3bonds so high energy is required for breaking
i.e. G  C content  temperature


21. (B)


22. (C)


23. (B)


24. (B)


25. (D)


26. (A)


27. (A)


28. (B)

CHEMISTRY

Q.1 – Q.6 carry one mark each


1. Which one of the following is not a state function?

(A) Enthalpy (H) (B) Internal energy (U)
(C) Work done (w) (D) entropy (S)


2. Specify which among the following statements describe uncertainty principle

(A) No two electrons in an atom can have the same set of four quantum numbers
(B) It is impossible to determine simultaneously the velocity and momentum of an object with certainty
(C) Matter like radiation exhibit a dual behavior
(D) It is impossible to simultaneously determine the position and momentum of an object with certainty


3. Among the given compounds, the most stable halogen containing compound of sulfur is

(A) SF6 (B) S2Cl2 (C) SF4 (D) SOCl2


4. The nucleophile among the following is

(A) BF3 (B) SO3 (C) (CH3)3N (D) NO2+


5. In the reaction
A + B  Products,
If the concentration of A is doubled, the rate of the reaction increases by a factor of 4. However, if the concentration of B is doubled, the rate remains unaltered. The order of the reaction with respect to A and B will be respectively

(A) 2 and 1 (B) 2 and 0 (C) 1 and 0 (D) 1 and 1


6. The major product (X) of the reaction
BrCH2–CH2–Br(zinc dust) (X) is

(A) H2C (B) CH2=CH–CH2Br
H2C
H2C
(C) BrCH2–CH=CH2 (D) CH2=C=CH2


Q.7 – Q.24 carry two marks each.

7. Which among the following steps is NOT present in the determination of lattice enthalpy of NaI using the Born – Harber cycle

(A) ½ I2(s)  ½ I2(g) (B) Na(s)  Na(l)
(C) ½ I2(g)  I(g) (D) I(g) + e¬ I(g)


8. The boiling point of pure benzene is 80.0C. When a certain amount of benzoic acid was added to it, the boiling point increased to 82.5C. If the ebullioscopic constant (Kb) is 2.5K kg mol–1, the molality of the solution will be

(A) 0.02 (B) 0.25 (C) 1.00 (D) 6.25


9. The structure of XeO2F2 based on VSEPR theory is best described as

(A) See–saw structure with the O–Xe–O angle close to 120
(B) See–saw structure with the F–Xe–F angle close to 120
(C) A perfect tetrahedral arrangement of substituents around Xe
(D) A square planar structure with the fluorines trans to each other.


10. The hydrolysis of which of the following compounds would yield phosphorous acid (H3PO3)?

(A) PCl5 (B) POCl3 (C) P4O10 (D) PCl3


11. The type of hybridization that chromium show in Cr(CO)6 and [CrF6]3 are respectively [atomic number of chromium is 24]

(A) sp3d2 and d2 sp3 (B) sp3d2 and sp3d2
(C) d2 sp3and d2 sp3 (D) d2 sp3 and sp3d2


12. Which among the following molecules has the lowest bond dissociation energy?

(A) NO (B) NO+ (C) NO (D) N2


13. A transition metal ion in its +3 oxidation state forms complexes with excess of F as well as Cl. Given that the ionic radii of the metal ion, F and Cl are 0.64, 1.34 and 1.81 A respectively, the geometries of the metal complexes formed will be

(A) [MF6]3, octahedral and [MCl4], tetrahedral
(B) [MF6]3, octahedral and [MCl6]3, octahedral
(C) [MF4], tetrahedral and [MCl4], tetrahedral
(D) [MF4], tetrahedral and [MCl6]3, octahedral


14. The reagent required for the conversion
H3C CH3
H3C–CCCH3  C=C
H (Cis) H

(A) Na in liquid ammonia (B) LiAlH4
(C) Sn/HCl (D) Pd/BaSO4/Quinoline


15. For the synthesis of

Using Diel`s – Alder reaction, the reactants required are




16. Match the values of Ka (given in column 2) with th substituted benzoic acids (given in column1)
Column 1 Column 2
[P] p–NO2 [X] 36105
[Q] p–OH [Y] 10105
[R] p–Cl [Z] 2.6105
(A) P–X; Q–Y; R–Z (B) P–Y; Q–X; R–Z
(C) P–Z; Q–Y; R–X (D) P–X; Q–Z; R–Y


17. The major products (X) and (Y) of the reactions
HBr/peroxide (78C)
[X]
CH3CH=CH2
HCl/peroxide (78C)
[Y]
Are
(A) X=CH3CHBrCH3; Y=CH3CHClCH3
(B) X=CH3CH2CH2Br; Y=CH3CHClCH3
(C) X=CH3CH2CH2Br; Y=CH3CH2CH2Cl
(D) X=CH3CHBrCH3; Y=CH3CH2CH2Cl


18. Nitration of p – nitrobiphenyl is carried out. The new nitro group would introduce at position/s


(A) P and T (B) only Q (C) R and T (D) Q and S

19. In the reaction
OCH3/CH3OH
CH3(CH2)3CH–CH3

X
If X=F in the first case and X=Br in the second case, the major product formed will be respectively

(A) 1Hexene and 1Hexene (B) 1Hexene and 2Hexene
(C) 2Hexene and 2Hexene (D) 2Hexene and 1Hexene


20. Henderson’s equation can be represented as

(A) pH=pKa+log[Acid]/[Salt] (B) pH=pKa+log[Salt]/[Acid]
(C) pKa=pH+log[Salt]/[Acid] (D) pKa=pHlog[Salt]/[Acid]


21. A concentration solution of NaCl is diluted ten times. The specific conductance () and molar conductance (m) will how the following behavior

(A) decrease in  and increase in m (C) no change in both
(B) increase in  and decrease in m (D)increase in both


22. In the reaction
2SO3(g)  2SO2(g) + O2(g)
Taking place at 27C, Kp is 3.01023 atm. The value of Kc (in mol dm3) for the reaction is [Given R=0.0821 dm3 atm K1 mol1]

(A) 741023 (B) 121025 (C) 51026 (D) 21027


Common Data Questions

Common Data for Questions 23, 24:

KMnO4 reacts with oxalic acid in the presence of excess H2SO4 to yield a manganese complex X which is colorless in dilute solutions and pale pin k in the crystalline form [atomic number of manganese in 25]

23. The number of unpaired electron present in the complex X is
(A) 1 (B) 3 (C) 4 (D) 5


24. The calculated spin only magnetic moment for the compound X is
(A) 5.92BM (B) 4.90BM (C) 3.87BM (D) 1.73BM


Linked Answer Questions: Q.25 to Q.28 carry two marks each.

Statement for Linked Answer Questions 25 & 26:

Benzene reacts with 1chloro2methylpropane in presence of anhydrous AlCl3 at 20C to give major product (X).


25. The product (X) is


26. Compound (X) on treatment with hot acidic KMnO4 followed by reaction with LiAlH4 gives (Y). Compound (Y)is


Statement for Linked Answer Questions 27 & 28:

Consider a cell:
Zn(s)Zn2+(aq)Cu2+(aq)Cu(s) operating at 298K
[Given E0 (Zn2+/Zn) = 0.763V and E0 (Cu/Cu2+) = 0.337V]

27. The emf of the cell (E0cell) will be
(A) 1.100V (B) 0.426V (C) 1.10V (D) 0.426V


28. The value of log K for the cell reaction:
Zn(s) + Cu2+(aq)  Zn2+(aq) + Cu(s)
where K is the equilibrium constant will be [Given R = 8.314 JK1mol1, F = 96,500 C mol1]
(A) 18.61 (B) 14.41 (C) 14.41 (D) 37.22



Solutions


1. (C) Work done is not a state function


2. (D)


3. (A) In SF6, all the six valency electrons are bonded with F atoms, where all others have lone pairs of electrons.


4. (C) There is a lone pair of electron in (CH3)3N, thus, which acts as a nucleophile.


5. (B)


6. (D) The reaction is dihalo – elimination


7. (B)


8. (C)


9. (B)


10. (D)


11. (C)


12. (C)


13. (A)


14. (D)


15. (D)


16. (D)


17. (B)


18. (A) Nitration of p – nitrobiphenyl gives substitution at ortho and para positions.


19. (B)


20. (B)


21. (A)


22. (B)


23. (D)


24. (A)


25. (C)


26. (B)


27. (A)


28. (D)

MICROBIOLOGY

Q. 1- 6 carry one mark each


1. Which of the following scientists developed the modern concept of chemotherapy and chemotherapeutic agents?

(A) Robert Koch
(B) Paul Ehrlich
(C) Joseph Lister
(D) Louis Pasteur


2. The refractive index of immersion oil used in microscopy to achieve higher resolution is

(A) Same as glass
(B) Less than air
(C) less than glass
(D) Same as air


3. Which one of the following synthetic antibacterial compound inhibits supercoiling of bacterial DNA

(A) Sulphonamide
(B) p-Fluorophenyl alanine
(C) Puromycin
(D) Rifampin


4. Which one of the following is not a lymphocyte?

(A) B-cell
(B) T cell
(C) NK-cell
(D) Mast cell


5. Which one of the following organism has a single stranded positive sense RNA genome?

(A) influenza virus
(B) poliovirus
(C) hepatitis B virus
(D) pox virus


6. Cyanobacteria comprises a large and morphologically heterogenous group of

(A) Chemoautotrophs
(B) Photoheterotrophs
(C) Photoatotrophs
(D) Chemoautotrophs


Q. 7-24 carry two marks each


7. In the peptidoglycan layer of bacterial cell wall, which of the following pair of amino acids are usually found n D-configuration?

(A) Alanine and glutamic acid (B) Alanine and lysine
(C) Alanine and arginine (D) Glutamic acid and lysine


8. Which of the following inclusion bodies contains the enzymes responsible for carbon dioxide fixation in bacteria?

(A) Lysosomes (B) Peroxisomes
(C) Metachromatic granules (D) Carboxysomes


9. When bacterial cells are placed in a 2 M NaCl solution, the plasmamembrane will

(A) Burst (B) Undergo plasmolysis
(C) Remain unchanged (D) Swell


10. Which of the following couple wiil have the maximum tendency to donate electrons? (Redox potentials aregiven in the parenthesis)

(A) 2H+/H2 (-0.42V) (B) NAD+/NADH(-0.32V)
(C) NO3-/NO2-(+0.42V) (D)1/2O2/H20 (+0.82)


11. Match the following group of microorganism with their oxygen requirements.
Group of microorganisms Oxygen requirement
P. Obligate aerobe 1. Grows equally well in presence or absence of oxygen
Q. Microaerophile 2. Grows only in presence of oxygen
R. Obligate anaerobe 3. Cannot tolerate oxygen
S. Aerotolerant anaerobe 4. Can grow only at reduced oxygen levels

(A) P-3; Q-1; R-2; S-4 (B) P-4; Q-3; R-2; S-1
(C) P-2; Q-4; R-3; S-1 (D) P-1; Q-4; R-3; S-2


12. In which of the following cases of microbial growth, lag phase usually does not occur?

(A) If inoculum is taken from old (stationary phase) culture and inoculated into same medium.
(B) Inoculum consists of damaged cells (but not killed), inoculated into the same medium
(C) Inoculum is transferred from a rich culture medium to a poorer one
(D) If an exponentially growing culture is inoculated into the same medium under the same conditions of growth


13. Which of the following statements is INCORRECT about bacterial endospore?

(A) Core pH is about 5.5 to 6.0
(B) Resistant to lysosome
(C) Dipicolinic acid is present
(D) Small acid soluble protein is absent


14. The following reaction of glycoxylate cycle requires two enzymes P and Q

Isocitrate (P) succinate + glycoxylate

Glycoxylate + acetyl CoA  (Q) malate + CoA

Which of the following combinations is the true representative of P and Q?

(A) Isocitrate lyase and malate synthase
(B) Isocitrate lyase and malate dehydrogenase
(C) Isocitrate dehydrogenase and malate dehydrogenase
(D) Isocitrate dehydrogenase and malate synthase


15. Which of the following statements is NOT included in Koch’s postulate?
(A) A specific organism can always be found in association with a given disease
(B) The organism can be isolated and grown in pure cultures in the laboratory
(C) The pure culture will produce the disease when inoculated into susceptible animal
(D) It is possible to clone the genome of the genome of the organism from the experimentally infected animal


16. The commercially used technique for pasteurization of milk involves low temperature holding (LTH) and high temperature short time (HTST) methods which of the following methods is INCORRECT?

(A) Expose milk to 145F for 30min
(B) Expose milk to 161F for 15sec
(C) Expose milk to 143F for 30min
(D) Expose milk to 71.7C for 15sec


17. The phenomenon in which a prophage is able to make changes in the properties of a host bacterium in lysogeny is termed as

(A) Immunity repression (B) Lysogenic induction
(C) Lysogenic conversion (D) Lytic infection


18. Phage typing is frequently used in medical diagnosis for the identification of certain strains of pathogens, such as

(A) Staphylococci (B) Enteroviruses
(C) Plasmodium falciparum (D) Leishmania donovani


19. Which of the following virus needs a helper virus for the genome replication?

(A) Hepatitis A (B) Hepatitis D
(C) Hepatitis C (D) Hepatitis E


20. Which of the following viruses usually causes ‘latent infection’ in the human neuronal cells?

(A) Polovirus (B) Japanese Encephalitis Virus
(C) Herpes simplex virus type I (D) Rabies virus


21. Match the correct combination of toxin and the mode of action

Toxin Mode of action
P. Pertussis toxin 1. Prevents release of glycine by nerve end
Q. Diphtheria toxin 2. Blocks G-protein signal transduction
R. Botulinum toxin 3. Induces fluid loss from intestinal cells
S. Tetanus toxin 4. Inhibits protein synthesis in eukaryotes
5. Causes haemolysis
6. Blocks release of acetylcholine by nerve end.

(A) P-3; Q-2; R-5; S-4 (B) P-2; Q-4; R-6; S-1
(C) P-5; Q-6; R-3; S-2 (D) P-1; Q-3; R-2; S-5


22. The following antibiotics affect the bacterial protein synthesis with their site of action. Which of the following combinations is correct?

Antibiotic Site of action
P. Streptomycin 1. aminoacyl tRNA association with ribosome
Q. Tetracycline 2. Transpeptidation
R. erythromycin 3. Translocation
S. Chloramphenicol 4. Initiation of protein synthesis

(A) P-2; Q-3; R-4; S-1 (B) P-4; Q-1; R-3; S-2
(C) P-1; Q-4; R-3; S-2 (D) P-4; Q-1; R-2; S-3


Common Data Questions

Common Data for Questions 23, 24

Besides the repression/depression control of tryptophan operon the second level of regulation is known as attenuation. The presence of two tryptophan codons within the trpL controls this phenomenon. The presence of tryptophan –charged tRNAtrp causes the premature termination of transcription, yields a 140 nucleotide long leader sequence transcript, By site directed mutagenesis the two UGG Trp codons of the trpL sequence were modified to CGG arginine codon (arg).


23. Which of the following amino acid(s) would be able to restore the attenuation control of trp operon?
(A) Tryptophan alone (B) Arginine alone
(C) Tryptophan or arginine (D) Neither arginine nor tryptophan


24. Deletion of part of the trpL region will result in

(A) Increase in the rate of expression of ‘trp’ structural genes
(B) Decrease in the rate of expression of ‘trp’ structural genes
(C) No change in the rate of expression of ‘Trp’ structural genes
(D) Inhibition of the expression of all the genes in the operon


Linked Answer Questions: Q.25 to Q.28 carry two marks each


Statement for Linked Answer Questions 25&26:

The nucleic acid from a microorganism was isolated and the base composition was determined to be as follows:
A = 35%, T = 15%, G = 35%, C = 15%


25. what could be the physical nature of nucleic acid?

(A) Double stranded circular DNA
(B) Double stranded linear DNA
(C) single stranded linear DNA
(D) Single stranded RNA


26. The optical density of the above nucleic acid was measured at 260nm wavelength at 37C and 95C, what possible changes could you expect in the optical density with the increase in temperature?

(A) Significant increase (B) Only two fold increase
(C) Significant decrease (D) No significant change


Statement for Linked Answer Questions 27&28:

In a bacterial culture initial cell population is 1 103 cells. The generation time of the bacterial cell is 20 minutes and the lag phase is 1hour.


27. If the culture is allowed to grow for 4hors, how many generations would take place?

(A) 8 (B) 12 (C) 10 (D) 9


28. What will be the cell population after 3hours?
(A) 6.4106 (B) 3.2104 (C) 3.2106 (D) 6.4104


ANSWERS



1. (c)
Robert Koch – introduced agar, bacteria as a cause of anthrax
Paul Ehrlich – use of salvarson for treatment of Syphilis
Joseph Lister – antiseptic techniques (phenol = carbolic acid) as disinfectant
Louis Pateur – pasteurization and theory of spontaneous generation


2. (A)
The bending of light takes place as it passes from glass to air and then to te glass lens, which decreases the resolving power. This decrease in resolution can be prevented by putting immersion oil between the slide and lens because the refractive index of the immersion oil is same as glass.


3. (B)
Sulfonamide – they interfere with bacterial DNA replication
Puromycin – inhibits protein synthesis in prokaryotes and eukaryotes by interfering with peptidyl transferases
Rifampin – inhibits prokaryotic transcription initiation


4. (D)


5. (B)

influenza virus – ss RNA
poliovirus, Hep C, Hep E, Hep AB all belong to same class
hepatitis B virus – ds DNA – RT virus
pox virus – ds DNA virus


6. (C)

Chemoautotrophs – microorganism which are able to synthesize organic compound from inorganic raw materials in absence of sunlight

Photoheterotrophs – use light as energy source, use organic compound as source of carbon
Photoautotrophs – use light energy and CO2 as source of carbon
Chemoheterotrophs – derive energy from organic molecules like glucose


7. (A)
NAN is composed of L-ala, D glutamine, L lysine and D-ala


8. (D)
Lysosomes – common in animals, rare in plants and bear hydrolytic enzymes necessary for intracellular digestion
Peroxisomes – are responsible for protecting cells from its own production of toxic H2 O2
Metachromatic granules – change the colour of staining dye
Carboxysomes – are micro compartment found in autotrophic bacteria ; they function to sequester RuBisCO


9. (B)

10. (A)
Electron donor is a reductant whereas electron acceptor is an oxidant. Relatively negative E values are associated with strong reductants and relatively positive values are associated with strong oxidants.


11. (C)


12. (D)


13. (D)


14. (A)


15. (D)


16. (C)


17. (A)


18. (A).


19. (B)

Delta agent is an antigen part of Hepatitis D virus. It is a defective virus which requires Hepatitis B as a helper virus inorder to replicate.


20. (C)


21. (B)


22. (B)


23. (A)


24. (A)


25. (C)


26. (A)


27. (D)


28. (D)